AntibodiesNeuroMab

Anti-KCND2 Antibody-Oligo Conjugate

SKU: aoc12

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-KCND2 Antibody-IF1

Antibody Target

Target
KCND2
UniProt Number
Q9NZV8
Target Description
Voltage-gated potassium channel that mediates transmembrane potassium transport in excitable membranes, primarily in the brain. Mediates the major part of the dendritic A-type current I(SA) in brain neurons. This current is activated at membrane potentials that are below the threshold for action potentials. It regulates neuronal excitability, prolongs the latency before the first spike in a series of action potentials, regulates the frequency of repetitive action potential firing, shortens the duration of action potentials and regulates the back-propagation of action potentials from the neuronal cell body to the dendrites. Contributes to the regulation of the circadian rhythm of action potential firing in suprachiasmatic nucleus neurons, which regulates the circadian rhythm of locomotor activity. Functions downstream of the metabotropic glutamate receptor GRM5 and plays a role in neuronal excitability and in nociception mediated by activation of GRM5. Mediates the transient outward current I(to) in rodent heart left ventricle apex cells, but not in human heart, where this current is mediated by another family member. Forms tetrameric potassium-selective channels through which potassium ions pass in accordance with their electrochemical gradient. The channel alternates between opened and closed conformations in response to the voltage difference across the membrane. Can form functional homotetrameric channels and heterotetrameric channels that contain variable proportions of KCND2 and KCND3; channel properties depend on the type of pore-forming alpha subunits that are part of the channel. In vivo, membranes probably contain a mixture of heteromeric potassium channel complexes. Interaction with specific isoforms of the regulatory subunits KCNIP1, KCNIP2, KCNIP3 or KCNIP4 strongly increases expression at the cell surface and thereby increases channel activity; it modulates the kinetics of channel activation and inactivation, shifts the threshold for channel activation to more negative voltage values, shifts the threshold for inactivation to less negative voltages and accelerates recovery after inactivation. Likewise, interaction with DPP6 or DPP10 promotes expression at the cell membrane and regulates both channel characteristics and activity. Upon depolarization, the channel goes from a resting closed state (C state) to an activated but non-conducting state (C* state), from there, the channel may either inactivate (I state) or open (O state).
Molecular Weight
75-80 kDa
Synonyms
Potassium voltage-gated channel subfamily D member 2 (Voltage-gated potassium channel subunit Kv4.2)

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICCIPEM
Specificity
No cross reactivity against rat Kv4.3
Clone
K57/1
Isotype
IgG1
Form
Liquid
Immunogen
Synthetic peptide amino acids 209 –225 (extracellular S1-S2 loop) of rat Kv4.2 (CGSSPGHIKELPSGERY; accession number Q63881)
Immunogen Species
Rat
Host Species
Mouse
Species Reactivity
HumanMouseRat