AntibodiesNeuroMab
Anti-KCND2 Antibody-Oligo Conjugate
SKU: aoc12
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KCND2 Antibody-IF1
Antibody Target
- Target
- KCND2
- UniProt Number
- Q9NZV8
- Target Description
- Kv4.2 K+ channel (Potassium voltage-gated channel subfamily D member 2 ) is a member of the mammalian Shal-related family and potassium voltage gated channel subunit family. Kv4 subunit family includes four Kv4 α subunits (Kv4.1, Kv4.2 and Kv4.3). However only Kv4.2 and Kv4.3 are predominantely expressed in the brain (Alfaro-Ruiz et al., 2019). Kv4.2 K+ is encoded by gene KCND2 in human. It helps to regulate the action potential's circadian rhythm firing in suprachiasmatic nucleus neurons. This process regulates the circadian rhythm of locomotor activity. It has been demonstrated that Kv 4.2 and Kv4.3 are often colocalized with pain-modulating molecules in rat spinal lamina II excitatory interneurons (Huang et al., 2005).
- Molecular Weight
- 75-80 kDa
- Synonyms
- Potassium voltage-gated channel subfamily D member 2 (Voltage-gated potassium channel subunit Kv4.2)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPEM
- Specificity
- No cross reactivity against rat Kv4.3
- Clone
- K57/1
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide amino acids 209 –225 (extracellular S1-S2 loop) of rat Kv4.2 (CGSSPGHIKELPSGERY; accession number Q63881)
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat