AntibodiesNeuroMab
Anti-KCND3 Antibody-Oligo Conjugate
SKU: aoc14
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KCND3 Antibody-IF1
Antibody Target
- Target
- KCND3
- UniProt Number
- Q9UK17
- Target Description
- Kv4.3 K+ channel (Potassium voltage-gated channel subfamily D member 3 ) is a member of the mammalian Shal-related family and the potassium voltage gated channel subunit family. Kv4 subunit family includes four Kv4 α subunits (Kv4.1, Kv4.2 and Kv4.3). However only Kv4.2 and Kv4.3 are predominantely epressed in the brain (Alfaro-Ruiz et al., 2005). KV4.3 subunit is encoded by gene KCND3 in human. It has been demonstrated that Kv 4.2 and Kv4.3 are often colocalized with pain-modulating molecules in rat spinal lamina II excitatory interneurons (Huang et al., 2005).
- Molecular Weight
- 75 kDa in rat brain membrane preparations
- Synonyms
- Potassium voltage-gated channel subfamily D member 3 (Voltage-gated potassium channel subunit Kv4.3)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity against rat Kv4.2 expressed in transfected cells.
- Clone
- K75/41
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 415-636 (cytoplasmic C- terminus) of rat Kv4.3 (accession number Q62897) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- DrosophilaHamsterHumanMouseRat