AntibodiesNeuroMab
Anti-KCNT1 Antibody-Oligo Conjugate
SKU: aoc22
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KCNT1 Antibody-IF1
Antibody Target
- Target
- KCNT1
- UniProt Number
- Q5JUK3
- Target Description
- Potassium channel subfamily T member 1 or -KCNT1/Slo2.2/Slack K+ channel is encoded by the gene KCNT1. Slo2.2 is a member of the the voltage-gated ion channel (vic) superfamily, and the KCNT protein family, which is made of KCNT1 and KCNT2. Slo2.2 functions as an outwardly rectifying potassium channel subunit to contribute to ion conductance and signaling pathways. Slo2.2 can be activated by high intracellular sodium or chloride levels. Slo2.2 is expressed at the membrane in many areas of the brain, brainstem, spinal cord, spleen and liver. Mutations in this gene cause the early-onset epileptic disorders
- Molecular Weight
- 140 kDa
- Synonyms
- Potassium channel subfamily T member 1 (Sequence like a calcium-activated potassium channel subunit)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity reported
- Clone
- N3/26
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 1168-1237 of rat Slo2.2 (accession number NP_068625) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat