Antibodies
Anti-KHSRP Antibody-Oligo Conjugate
SKU: aoc2551
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KHSRP Antibody-IF1
Antibody Target
- Target
- Far upstream element-binding protein 2
- UniProt Number
- Q92945
- Target Description
- Binds to the dendritic targeting element and may play a role in mRNA trafficking (By similarity). Part of a ternary complex that binds to the downstream control sequence (DCS) of the pre-mRNA. Mediates exon inclusion in transcripts that are subject to tissue-specific alternative splicing. May interact with single-stranded DNA from the far-upstream element (FUSE). May activate gene expression. Also involved in degradation of inherently unstable mRNAs that contain AU-rich elements (AREs) in their 3'-UTR, possibly by recruiting degradation machinery to ARE-containing mRNAs..
- Molecular Weight
- 73 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC1402
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat