Antibodies
Anti-KIF3A Antibody-Oligo Conjugate
SKU: aoc2553
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KIF3A Antibody-IF1
Antibody Target
- Target
- Kinesin-like protein KIF3A
- UniProt Number
- Q9Y496
- Target Description
- Microtubule-based anterograde translocator for membranous organelles. Plus end-directed microtubule sliding activity in vitro. Plays a role in primary cilia formation. Plays a role in centriole cohesion and subdistal appendage organization and function. Regulates the formation of the subdistal appendage via recruitment of DCTN1 to the centriole. Also required for ciliary basal feet formation and microtubule anchoring to mother centriole..
- Molecular Weight
- 80kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1428
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat