Antibodies
Anti-KIF4A Antibody-Oligo Conjugate
SKU: aoc2554
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KIF4A Antibody-IF1
Antibody Target
- Target
- Chromosome-associated kinesin KIF4A
- UniProt Number
- O95239
- Target Description
- Iron-sulfur (Fe-S) cluster binding motor protein that has a role in chromosome segregation during mitosis (PubMed:29848660). Translocates PRC1 to the plus ends of interdigitating spindle microtubules during the metaphase to anaphase transition, an essential step for the formation of an organized central spindle midzone and midbody and for successful cytokinesis (PubMed:15297875, PubMed:15625105). May play a role in mitotic chromosomal positioning and bipolar spindle stabilization (By similarity)..
- Molecular Weight
- 140kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1405
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat