Antibodies
Anti-KLF4 Antibody-Oligo Conjugate
SKU: aoc2562
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-KLF4 Antibody-IF1
Antibody Target
- Target
- Krueppel-like factor 4
- UniProt Number
- O43474
- Target Description
- Transcription factor; can act both as activator and as repressor. Binds the 5'-CACCC-3' core sequence. Binds to the promoter region of its own gene and can activate its own transcription. Regulates the expression of key transcription factors during embryonic development. Plays an important role in maintaining embryonic stem cells, and in preventing their differentiation. Required for establishing the barrier function of the skin and for postnatal maturation and maintenance of the ocular surface. Involved in the differentiation of epithelial cells and may also function in skeletal and kidney development. Contributes to the down-regulation of p53/TP53 transcription..
- Molecular Weight
- 55 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC0721
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- A synthetic peptide corresponding to a sequence within amino acids 300-400 of human KLF4 (O43474).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat