Antibodies
Anti-Ku70 Antibody-Oligo Conjugate
SKU: aoc2570
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Ku70 Antibody-IF1
Antibody Target
- Target
- X-ray repair cross-complementing protein 6
- UniProt Number
- P12956
- Target Description
- Single-stranded DNA-dependent ATP-dependent helicase that plays a key role in DNA non-homologous end joining (NHEJ) by recruiting DNA-PK to DNA. Required for double-strand break repair and V(D)J recombination. Also has a role in chromosome translocation. Has a role in chromosome translocation. The DNA helicase II complex binds preferentially to fork-like ends of double-stranded DNA in a cell cycle-dependent manner. It works in the 3'-5' direction. During NHEJ, the XRCC5-XRRC6 dimer performs the recognition step: it recognizes and binds to the broken ends of the DNA and protects them from further resection. Binding to DNA may be mediated by XRCC6. The XRCC5-XRRC6 dimer acts as a regulatory subunit of the DNA-dependent protein kinase complex DNA-PK by increasing the affinity of the catalytic subunit PRKDC to DNA by 100-fold. The XRCC5-XRRC6 dimer is probably involved in stabilizing broken DNA ends and bringing them together. The assembly of the DNA-PK complex to DNA ends is required for the NHEJ ligation step. Probably also acts as a 5'-deoxyribose-5-phosphate lyase (5'-dRP lyase), by catalyzing the beta-elimination of the 5' deoxyribose-5-phosphate at an abasic site near double-strand breaks. 5'-dRP lyase activity allows to 'clean' the termini of abasic sites, a class of nucleotide damage commonly associated with strand breaks, before such broken ends can be joined. The XRCC5-XRRC6 dimer together with APEX1 acts as a negative regulator of transcription. In association with NAA15, the XRCC5-XRRC6 dimer binds to the osteocalcin promoter and activates osteocalcin expression. Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway. Negatively regulates apoptosis by interacting with BAX and sequestering it from the mitochondria. Might have deubiquitination activity, acting on BAX.
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0551
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat