Antibodies
Anti-Ku70 Antibody-Oligo Conjugate
SKU: aoc2570
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Ku70 Antibody-IF1
Antibody Target
- Target
- X-ray repair cross-complementing protein 6
- UniProt Number
- P12956
- Target Description
- Single-stranded DNA-dependent ATP-dependent helicase that plays a key role in DNA non-homologous end joining (NHEJ) by recruiting DNA-PK to DNA (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). Required for double-strand break repair and V(D)J recombination (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). Also has a role in chromosome translocation (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). Has a role in chromosome translocation (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). The DNA helicase II complex binds preferentially to fork-like ends of double-stranded DNA in a cell cycle-dependent manner (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). It works in the 3'-5' direction (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). During NHEJ, the XRCC5-XRRC6 dimer performs the recognition step: it recognizes and binds to the broken ends of the DNA and protects them from further resection (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). Binding to DNA may be mediated by XRCC6 (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). The XRCC5-XRRC6 dimer acts as a regulatory subunit of the DNA-dependent protein kinase complex DNA-PK by increasing the affinity of the catalytic subunit PRKDC to DNA by 100-fold (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). The XRCC5-XRRC6 dimer is probably involved in stabilizing broken DNA ends and bringing them together (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). The assembly of the DNA-PK complex to DNA ends is required for the NHEJ ligation step (PubMed:11493912, PubMed:12145306, PubMed:20493174, PubMed:2466842, PubMed:7957065, PubMed:8621488, PubMed:9742108). Probably also acts as a 5'-deoxyribose-5-phosphate lyase (5'-dRP lyase), by catalyzing the beta-elimination of the 5' deoxyribose-5-phosphate at an abasic site near double-strand breaks (PubMed:20383123). 5'-dRP lyase activity allows to 'clean' the termini of abasic sites, a class of nucleotide damage commonly associated with strand breaks, before such broken ends can be joined (PubMed:20383123). The XRCC5-XRRC6 dimer together with APEX1 acts as a negative regulator of transcription (PubMed:8621488). In association with NAA15, the XRCC5-XRRC6 dimer binds to the osteocalcin promoter and activates osteocalcin expression (PubMed:12145306). Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway (PubMed:28712728). Negatively regulates apoptosis by interacting with BAX and sequestering it from the mitochondria (PubMed:15023334). Might have deubiquitination activity, acting on BAX (PubMed:18362350)..
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0551
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat