AntibodiesNeuroMab
Anti-Kv1.1 Potassium Channel Antibody-Oligo Conjugate
SKU: aoc20
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Kv1.1 Potassium Channel Antibody-IF1
Antibody Target
- Target
- Kv1.1 Potassium Channel
- UniProt Number
- Q09470
- Target Description
- Potassium Channel Kv1.1 or Kcna1 is a member of the Shaker potassium channel family. Kv1.1 is expressed in the brain, CNS and in the kidney. Potassium channels form homotetrameric and heterotetrameric channels in the membrane with various other related proteins, including KCNA2, KCNA4, KCNA5, KCNA6, KCNA7. Kv1.1 is involved with the regulation of cellular functions and the control of neuronal excitability. Mutations in Kv1.1 are associated with Episodic ataxia type 1 and epilepsy.
- Molecular Weight
- 85 kDa (major: mature glycosylation)65 kDa (minor: immature glycosylation)
- Synonyms
- Potassium voltage-gated channel subfamily A member 1 (RBKI) (RCK1) (Voltage-gated potassium channel subunit Kv1.1)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity reported
- Clone
- K20/78
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Synthetic peptide amino acids 458-476 (cytoplasmic C-terminus) of rat Kv1.1 (EEDMNNSIAHYRQANIRTG; accession number P10499)
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- FinchHumanMouseRabbitRat