AntibodiesNeuroMab
Anti-Kv3.1B K+ Channel Antibody-Oligo Conjugate
SKU: aoc21
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Kv3.1B K+ Channel Antibody-IF1
Antibody Target
- Target
- Kv3.1b K+ channel
- UniProt Number
- P48547
- Target Description
- Potassium voltage-gated channel subfamily C member 1, or Kv3.1b is encoded by the gene KCNC1. Kv3.1 is a member of the Shaw subfamily of voltage gated potassium channels. Kv3.1b is expressed in many parts of the brain including the cerebellum, globus pallidus, subthalamic nucleus, substantia nigra, cortical and hippocampal in neurons at presynaptic membranes. It is also expressed in retinal ganglion cells and muscle and testis tissues. It is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Its function is important in repolarization of action potentials and is expressed in neurons that execute repetitive high frequency firing. Alterations in expression are associated with certain types of epilepsy, spinocerebellar ataxia, unverricht-lundborg syndrome and demyelinating diseases.
- Molecular Weight
- 110 kDa
- Synonyms
- Potassium voltage-gated channel subfamily C member 1 (NGK2) (RAW2) (Voltage-gated potassium channel subunit Kv3.1) (Voltage-gated potassium channel subunit Kv4)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIP
- Specificity
- No cross-reactivity reported
- Clone
- N16B/8
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 437-585 (cytoplasmic C-terminus) of rat Kv3.1b (accession number P25122) produced recombinantly in E. Coli
- Immunogen Species
- Rat
- Host Species
- Mouse
- Species Reactivity
- HamsterHumanMonkey (Non-Human Primate)MouseRat