Antibodies
Anti-L1CAM Antibody-Oligo Conjugate
SKU: aoc2573
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-L1CAM Antibody-IF1
Antibody Target
- Target
- Neural cell adhesion molecule L1
- UniProt Number
- P32004
- Target Description
- Neural cell adhesion molecule involved in the dynamics of cell adhesion and in the generation of transmembrane signals at tyrosine kinase receptors. During brain development, critical in multiple processes, including neuronal migration, axonal growth and fasciculation, and synaptogenesis. In the mature brain, plays a role in the dynamics of neuronal structure and function, including synaptic plasticity..
- Molecular Weight
- 140kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC57419
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human