Antibodies
Anti-Lamin B1 Antibody-Oligo Conjugate
SKU: aoc1006
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Lamin B1 Antibody-IF1
Antibody Target
- Target
- Lamin-B1
- UniProt Number
- P20700
- Target Description
- Lamins are intermediate filament proteins that assemble into a filamentous meshwork, and which constitute the major components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner nuclear membrane (PubMed:28716252, PubMed:32910914). Lamins provide a framework for the nuclear envelope, bridging the nuclear envelope and chromatin, thereby playing an important role in nuclear assembly, chromatin organization, nuclear membrane and telomere dynamics (PubMed:28716252, PubMed:32910914). The structural integrity of the lamina is strictly controlled by the cell cycle, as seen by the disintegration and formation of the nuclear envelope in prophase and telophase, respectively (PubMed:28716252, PubMed:32910914)..
- Molecular Weight
- 66kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC70485
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat