Antibodies
Anti-Lamin B2 Antibody-Oligo Conjugate
SKU: aoc2580
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Lamin B2 Antibody-IF1
Antibody Target
- Target
- Lamin-B2
- UniProt Number
- Q03252
- Target Description
- Lamins are intermediate filament proteins that assemble into a filamentous meshwork, and which constitute the major components of the nuclear lamina, a fibrous layer on the nucleoplasmic side of the inner nuclear membrane. Lamins provide a framework for the nuclear envelope, bridging the nuclear envelope and chromatin, thereby playing an important role in nuclear assembly, chromatin organization, nuclear membrane and telomere dynamics. The structural integrity of the lamina is strictly controlled by the cell cycle, as seen by the disintegration and formation of the nuclear envelope in prophase and telophase, respectively.
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1252
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat