Antibodies
Anti-Laminin beta 1 Antibody-Oligo Conjugate
SKU: aoc2581
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Laminin beta 1 Antibody-IF1
Antibody Target
- Target
- Laminin subunit beta-1
- UniProt Number
- P07942
- Target Description
- Binding to cells via a high affinity receptor, laminin is thought to mediate the attachment, migration and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. Involved in the organization of the laminar architecture of cerebral cortex. It is probably required for the integrity of the basement membrane/glia limitans that serves as an anchor point for the endfeet of radial glial cells and as a physical barrier to migrating neurons. Radial glial cells play a central role in cerebral cortical development, where they act both as the proliferative unit of the cerebral cortex and a scaffold for neurons migrating toward the pial surface.
- Molecular Weight
- 198kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0985
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat