Antibodies
Anti-LAMP2 Antibody-Oligo Conjugate (ARC0274)
SKU: aoc2582
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LAMP2 Antibody (ARC0274)-IF1
Antibody Target
- Target
- Lysosome-associated membrane glycoprotein 2
- UniProt Number
- P13473
- Target Description
- Lysosomal membrane glycoprotein which plays an important role in lysosome biogenesis, lysosomal pH regulation and autophagy. Acts as an important regulator of lysosomal lumen pH regulation by acting as a direct inhibitor of the proton channel TMEM175, facilitating lysosomal acidification for optimal hydrolase activity. Plays an important role in chaperone-mediated autophagy, a process that mediates lysosomal degradation of proteins in response to various stresses and as part of the normal turnover of proteins with a long biological half-live. Functions by binding target proteins, such as GAPDH, NLRP3 and MLLT11, and targeting them for lysosomal degradation. In the chaperone-mediated autophagy, acts downstream of chaperones, such as HSPA8/HSC70, which recognize and bind substrate proteins and mediate their recruitment to lysosomes, where target proteins bind LAMP2. Plays a role in lysosomal protein degradation in response to starvation. Required for the fusion of autophagosomes with lysosomes during autophagy. Cells that lack LAMP2 express normal levels of VAMP8, but fail to accumulate STX17 on autophagosomes, which is the most likely explanation for the lack of fusion between autophagosomes and lysosomes. Required for normal degradation of the contents of autophagosomes. Required for efficient MHC class II-mediated presentation of exogenous antigens via its function in lysosomal protein degradation; antigenic peptides generated by proteases in the endosomal/lysosomal compartment are captured by nascent MHC II subunits. Is not required for efficient MHC class II-mediated presentation of endogenous antigens.; FUNCTION: [Isoform LAMP-2C]: Modulates chaperone-mediated autophagy. Decreases presentation of endogenous antigens by MHCII. Does not play a role in the presentation of exogenous and membrane-derived antigens by MHCII.; FUNCTION: (Microbial infection) Supports the FURIN-mediated cleavage of mumps virus fusion protein F by interacting with both FURIN and the unprocessed form but not the processed form of the viral protein F.
- Molecular Weight
- 45kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0274
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat