Antibodies
Anti-LAP3 Antibody-Oligo Conjugate
SKU: aoc2584
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LAP3 Antibody-IF1
Antibody Target
- Target
- Cytosol aminopeptidase
- UniProt Number
- P28838
- Target Description
- Cytosolic metallopeptidase that catalyzes the removal of unsubstituted N-terminal hydrophobic amino acids from various peptides. The presence of Zn(2+) ions is essential for the peptidase activity, and the association with other cofactors can modulate the substrate spectificity of the enzyme. For instance, in the presence of Mn(2+), it displays a specific Cys-Gly hydrolyzing activity of Cys-Gly-S-conjugates. Involved in the metabolism of glutathione and in the degradation of glutathione S-conjugates, which may play a role in the control of the cell redox status..
- Molecular Weight
- 56kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC71182
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat