Antibodies
Anti-LC3A Antibody-Oligo Conjugate (ARC0319)
SKU: aoc2587
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LC3A Antibody (ARC0319)-IF1
Antibody Target
- Target
- Microtubule-associated protein 1 light chain 3 alpha
- UniProt Number
- Q9H492
- Target Description
- Ubiquitin-like modifier involved in formation of autophagosomal vacuoles (autophagosomes) (PubMed:20713600, PubMed:24290141). While LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation (PubMed:20713600). Through its interaction with the reticulophagy receptor TEX264, participates in the remodeling of subdomains of the endoplasmic reticulum into autophagosomes upon nutrient stress, which then fuse with lysosomes for endoplasmic reticulum turnover (PubMed:31006537, PubMed:31006538)..
- Molecular Weight
- 14 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0319
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat