Antibodies
Anti-Legumain Antibody-Oligo Conjugate (ARC61577)
SKU: aoc2595
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Legumain Antibody (ARC61577)-IF1
Antibody Target
- Target
- Legumain
- UniProt Number
- Q99538
- Target Description
- Has a strict specificity for hydrolysis of asparaginyl bonds. Can also cleave aspartyl bonds slowly, especially under acidic conditions. Involved in the processing of proteins for MHC class II antigen presentation in the lysosomal/endosomal system. Also involved in MHC class I antigen presentation in cross-presenting dendritic cells by mediating cleavage and maturation of Perforin-2 (MPEG1), thereby promoting antigen translocation in the cytosol. Required for normal lysosomal protein degradation in renal proximal tubules. Required for normal degradation of internalized EGFR. Plays a role in the regulation of cell proliferation via its role in EGFR degradation.
- Molecular Weight
- 42kDa/49kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC61577
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat