Antibodies
Anti-LIMK1 Antibody-Oligo Conjugate
SKU: aoc2606
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LIMK1 Antibody-IF1
Antibody Target
- Target
- LIM domain kinase 1
- UniProt Number
- P53667
- Target Description
- Serine/threonine-protein kinase that plays an essential role in the regulation of actin filament dynamics. Acts downstream of several Rho family GTPase signal transduction pathways. Activated by upstream kinases including ROCK1, PAK1 and PAK4, which phosphorylate LIMK1 on a threonine residue located in its activation loop. LIMK1 subsequently phosphorylates and inactivates the actin binding/depolymerizing factors cofilin-1/CFL1, cofilin-2/CFL2 and destrin/DSTN, thereby preventing the cleavage of filamentous actin (F-actin), and stabilizing the actin cytoskeleton. In this way LIMK1 regulates several actin-dependent biological processes including cell motility, cell cycle progression, and differentiation. Phosphorylates TPPP on serine residues, thereby promoting microtubule disassembly. Stimulates axonal outgrowth and may be involved in brain development.; FUNCTION: [Isoform 3]: Has a dominant negative effect on actin cytoskeletal changes. Required for atypical chemokine receptor ACKR2-induced phosphorylation of cofilin (CFL1).
- Molecular Weight
- 33kDa/68kDa/70kDa/72kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61299
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat