Antibodies
Anti-LIMK1 Antibody-Oligo Conjugate
SKU: aoc2606
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LIMK1 Antibody-IF1
Antibody Target
- Target
- LIM domain kinase 1
- UniProt Number
- P53667
- Target Description
- Serine/threonine-protein kinase that plays an essential role in the regulation of actin filament dynamics. Acts downstream of several Rho family GTPase signal transduction pathways (PubMed:10436159, PubMed:11832213, PubMed:12807904, PubMed:15660133, PubMed:16230460, PubMed:18028908, PubMed:22328514, PubMed:23633677). Activated by upstream kinases including ROCK1, PAK1 and PAK4, which phosphorylate LIMK1 on a threonine residue located in its activation loop (PubMed:10436159). LIMK1 subsequently phosphorylates and inactivates the actin binding/depolymerizing factors cofilin-1/CFL1, cofilin-2/CFL2 and destrin/DSTN, thereby preventing the cleavage of filamentous actin (F-actin), and stabilizing the actin cytoskeleton (PubMed:11832213, PubMed:15660133, PubMed:16230460, PubMed:23633677). In this way LIMK1 regulates several actin-dependent biological processes including cell motility, cell cycle progression, and differentiation (PubMed:11832213, PubMed:15660133, PubMed:16230460, PubMed:23633677). Phosphorylates TPPP on serine residues, thereby promoting microtubule disassembly (PubMed:18028908). Stimulates axonal outgrowth and may be involved in brain development (PubMed:18028908)..; FUNCTION: [Isoform 3]: Has a dominant negative effect on actin cytoskeletal changes. Required for atypical chemokine receptor ACKR2-induced phosphorylation of cofilin (CFL1)..
- Molecular Weight
- 33kDa/68kDa/70kDa/72kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61299
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat