Antibodies
Anti-LIN28B Antibody-Oligo Conjugate
SKU: aoc2608
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LIN28B Antibody-IF1
Antibody Target
- Target
- Protein lin-28 homolog B
- UniProt Number
- Q6ZN17
- Target Description
- Suppressor of microRNA (miRNA) biogenesis, including that of let-7 and possibly of miR107, miR-143 and miR-200c. Binds primary let-7 transcripts (pri-let-7), including pri-let-7g and pri-let-7a-1, and sequester them in the nucleolus, away from the microprocessor complex, hence preventing their processing into mature miRNA. Does not act on pri-miR21. The repression of let-7 expression is required for normal development and contributes to maintain the pluripotent state of embryonic stem cells by preventing let-7-mediated differentiation. When overexpressed, recruits ZCCHC11/TUT4 uridylyltransferase to pre-let-7 transcripts, leading to their terminal uridylation and degradation. This activity might not be relevant in vivo, as LIN28B-mediated inhibition of let-7 miRNA maturation appears to be ZCCHC11-independent. Interaction with target pre-miRNAs occurs via an 5'-GGAG-3' motif in the pre-miRNA terminal loop. Mediates MYC-induced let-7 repression. When overexpressed, isoform 1 stimulates growth of the breast adenocarcinoma cell line MCF-7. Isoform 2 has no effect on cell growth.
- Molecular Weight
- 27kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIHCELISA
- Clone
- ARC1616
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human