Antibodies
Anti-Lipocalin-2/NGAL Antibody-Oligo Conjugate
SKU: aoc2610
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Lipocalin-2/NGAL Antibody-IF1
Antibody Target
- Target
- Neutrophil gelatinase-associated lipocalin
- UniProt Number
- P80188
- Additional Target Information
- This antibody also binds Neutrophil gelatinase-associated lipocalin, Uniprot:P11672.
- Target Description
- Iron-trafficking protein involved in multiple processes such as apoptosis, innate immunity and renal development. Binds iron through association with 2,3-dihydroxybenzoic acid (2,3-DHBA), a siderophore that shares structural similarities with bacterial enterobactin, and delivers or removes iron from the cell, depending on the context. Iron-bound form (holo-24p3) is internalized following binding to the SLC22A17 (24p3R) receptor, leading to release of iron and subsequent increase of intracellular iron concentration. In contrast, association of the iron-free form (apo-24p3) with the SLC22A17 (24p3R) receptor is followed by association with an intracellular siderophore, iron chelation and iron transfer to the extracellular medium, thereby reducing intracellular iron concentration. Involved in apoptosis due to interleukin-3 (IL3) deprivation: iron-loaded form increases intracellular iron concentration without promoting apoptosis, while iron-free form decreases intracellular iron levels, inducing expression of the proapoptotic protein BCL2L11/BIM, resulting in apoptosis. Involved in innate immunity; limits bacterial proliferation by sequestering iron bound to microbial siderophores, such as enterobactin. Can also bind siderophores from M.tuberculosis.
- Molecular Weight
- 23kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human/Mouse
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse