Antibodies
Anti-LKB1 Antibody-Oligo Conjugate
SKU: aoc2613
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LKB1 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase STK11
- UniProt Number
- Q15831
- Target Description
- Tumor suppressor serine/threonine-protein kinase that controls the activity of AMP-activated protein kinase (AMPK) family members, thereby playing a role in various processes such as cell metabolism, cell polarity, apoptosis and DNA damage response. Acts by phosphorylating the T-loop of AMPK family proteins, thus promoting their activity: phosphorylates PRKAA1, PRKAA2, BRSK1, BRSK2, MARK1, MARK2, MARK3, MARK4, NUAK1, NUAK2, SIK1, SIK2, SIK3 and SNRK but not MELK. Also phosphorylates non-AMPK family proteins such as STRADA, PTEN and possibly p53/TP53. Acts as a key upstream regulator of AMPK by mediating phosphorylation and activation of AMPK catalytic subunits PRKAA1 and PRKAA2 and thereby regulates processes including: inhibition of signaling pathways that promote cell growth and proliferation when energy levels are low, glucose homeostasis in liver, activation of autophagy when cells undergo nutrient deprivation, and B-cell differentiation in the germinal center in response to DNA damage. Also acts as a regulator of cellular polarity by remodeling the actin cytoskeleton. Required for cortical neuron polarization by mediating phosphorylation and activation of BRSK1 and BRSK2, leading to axon initiation and specification. Involved in DNA damage response: interacts with p53/TP53 and recruited to the CDKN1A/WAF1 promoter to participate in transcription activation. Able to phosphorylate p53/TP53; the relevance of such result in vivo is however unclear and phosphorylation may be indirect and mediated by downstream STK11/LKB1 kinase NUAK1. Also acts as a mediator of p53/TP53-dependent apoptosis via interaction with p53/TP53: translocates to the mitochondrion during apoptosis and regulates p53/TP53-dependent apoptosis pathways. Regulates UV radiation-induced DNA damage response mediated by CDKN1A. In association with NUAK1, phosphorylates CDKN1A in response to UV radiation and contributes to its degradation which is necessary for optimal DNA repair.; FUNCTION: [Isoform 2]: Has a role in spermiogenesis.
- Molecular Weight
- 49kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC58343
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat