Antibodies
Anti-LPP Antibody-Oligo Conjugate
SKU: aoc2621
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LPP Antibody-IF1
Antibody Target
- Target
- Lipoma-preferred partner
- UniProt Number
- Q93052
- Target Description
- May play a structural role at sites of cell adhesion in maintaining cell shape and motility. In addition to these structural functions, it may also be implicated in signaling events and activation of gene transcription. May be involved in signal transduction from cell adhesion sites to the nucleus allowing successful integration of signals arising from soluble factors and cell-cell adhesion sites. Also suggested to serve as a scaffold protein upon which distinct protein complexes are assembled in the cytoplasm and in the nucleus.
- Molecular Weight
- 66kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2381
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse