Antibodies
Anti-LRP2 Antibody-Oligo Conjugate
SKU: aoc2623
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LRP2 Antibody-IF1
Antibody Target
- Target
- Low-density lipoprotein receptor-related protein 2
- UniProt Number
- P98164
- Target Description
- Multiligand endocytic receptor. Acts together with CUBN to mediate endocytosis of high-density lipoproteins. Mediates receptor-mediated uptake of polybasic drugs such as aprotinin, aminoglycosides and polymyxin B. In the kidney, mediates the tubular uptake and clearance of leptin. Also mediates transport of leptin across the blood-brain barrier through endocytosis at the choroid plexus epithelium. Endocytosis of leptin in neuronal cells is required for hypothalamic leptin signaling and leptin-mediated regulation of feeding and body weight. Mediates endocytosis and subsequent lysosomal degradation of CST3 in kidney proximal tubule cells. Mediates renal uptake of 25-hydroxyvitamin D3 in complex with the vitamin D3 transporter GC/DBP. Mediates renal uptake of metallothionein-bound heavy metals. Together with CUBN, mediates renal reabsorption of myoglobin. Mediates renal uptake and subsequent lysosomal degradation of APOM. Plays a role in kidney selenium homeostasis by mediating renal endocytosis of selenoprotein SEPP1. Mediates renal uptake of the antiapoptotic protein BIRC5/survivin which may be important for functional integrity of the kidney. Mediates renal uptake of matrix metalloproteinase MMP2 in complex with metalloproteinase inhibitor TIMP1. Mediates endocytosis of Sonic hedgehog protein N-product (ShhN), the active product of SHH. Also mediates ShhN transcytosis. In the embryonic neuroepithelium, mediates endocytic uptake and degradation of BMP4, is required for correct SHH localization in the ventral neural tube and plays a role in patterning of the ventral telencephalon. Required at the onset of neurulation to sequester SHH on the apical surface of neuroepithelial cells of the rostral diencephalon ventral midline and to control PTCH1-dependent uptake and intracellular trafficking of SHH. During neurulation, required in neuroepithelial cells for uptake of folate bound to the folate receptor FOLR1 which is necessary for neural tube closure. In the adult brain, negatively regulates BMP signaling in the subependymal zone which enables neurogenesis to proceed. In astrocytes, mediates endocytosis of ALB which is required for the synthesis of the neurotrophic factor oleic acid. Involved in neurite branching. During optic nerve development, required for SHH-mediated migration and proliferation of oligodendrocyte precursor cells. Mediates endocytic uptake and clearance of SHH in the retinal margin which protects retinal progenitor cells from mitogenic stimuli and keeps them quiescent. Plays a role in reproductive organ development by mediating uptake in reproductive tissues of androgen and estrogen bound to the sex hormone binding protein SHBG. Mediates endocytosis of angiotensin-2. Also mediates endocytosis of angiotensis 1-7. Binds to the complex composed of beta-amyloid protein 40 and CLU/APOJ and mediates its endocytosis and lysosomal degradation. Required for embryonic heart development. Required for normal hearing, possibly through interaction with estrogen in the inner ear.
- Molecular Weight
- 522kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCFC (intra)ELISA
- Clone
- ARC63830
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat