AntibodiesNeuroMab
Anti-LRRK2 Antibody-Oligo Conjugate
SKU: aoc27
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LRRK2 Antibody-IF1
Antibody Target
- Target
- LRRK2
- UniProt Number
- Q5S007
- Target Description
- Serine/threonine-protein kinase which phosphorylates a broad range of proteins involved in multiple processes such as neuronal plasticity, innate immunity, autophagy, and vesicle trafficking. Is a key regulator of RAB GTPases by regulating the GTP/GDP exchange and interaction partners of RABs through phosphorylation. Phosphorylates RAB3A, RAB3B, RAB3C, RAB3D, RAB5A, RAB5B, RAB5C, RAB8A, RAB8B, RAB10, RAB12, RAB29, RAB35, and RAB43. Regulates the RAB3IP-catalyzed GDP/GTP exchange for RAB8A through the phosphorylation of 'Thr-72' on RAB8A. Inhibits the interaction between RAB8A and GDI1 and/or GDI2 by phosphorylating 'Thr-72' on RAB8A. Regulates primary ciliogenesis through phosphorylation of RAB8A and RAB10, which promotes SHH signaling in the brain. Together with RAB29, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose-6-phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner. Regulates neuronal process morphology in the intact central nervous system (CNS). Plays a role in synaptic vesicle trafficking. Plays an important role in recruiting SEC16A to endoplasmic reticulum exit sites (ERES) and in regulating ER to Golgi vesicle-mediated transport and ERES organization. Positively regulates autophagy through a calcium-dependent activation of the CaMKK/AMPK signaling pathway. The process involves activation of nicotinic acid adenine dinucleotide phosphate (NAADP) receptors, increase in lysosomal pH, and calcium release from lysosomes. Phosphorylates PRDX3. By phosphorylating APP on 'Thr-743', which promotes the production and the nuclear translocation of the APP intracellular domain (AICD), regulates dopaminergic neuron apoptosis. Acts as a positive regulator of innate immunity by mediating phosphorylation of RIPK2 downstream of NOD1 and NOD2, thereby enhancing RIPK2 activation. Independent of its kinase activity, inhibits the proteasomal degradation of MAPT, thus promoting MAPT oligomerization and secretion. In addition, has GTPase activity via its Roc domain which regulates LRRK2 kinase activity. Recruited by RAB29/RAB7L1 to overloaded lysosomes where it phosphorylates and stabilizes RAB8A and RAB10 which promote lysosomal content release and suppress lysosomal enlargement through the EHBP1 and EHBP1L1 effector proteins.
- Molecular Weight
- >200 kDa
- Synonyms
- Leucine-rich repeat serine/threonine-protein kinase 2 (EC 2.7.11.1) (Dardarin)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity reported
- Clone
- 8G10
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 100-500 (N-terminus) of human LRRK2 (accession number Q5S007) produced recombinantly in E. Coli.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat