AntibodiesNeuroMab

Anti-LRRK2 Antibody-Oligo Conjugate

SKU: aoc27

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-LRRK2 Antibody-IF1

Antibody Target

Target
LRRK2
UniProt Number
Q5S007
Target Description
Serine/threonine-protein kinase which phosphorylates a broad range of proteins involved in multiple processes such as neuronal plasticity, innate immunity, autophagy, and vesicle trafficking (PubMed:17114044, PubMed:20949042, PubMed:21850687, PubMed:22012985, PubMed:23395371, PubMed:24687852, PubMed:25201882, PubMed:26014385, PubMed:26824392, PubMed:27830463, PubMed:28720718, PubMed:29125462, PubMed:29127255, PubMed:29212815, PubMed:30398148, PubMed:30635421). Is a key regulator of RAB GTPases by regulating the GTP/GDP exchange and interaction partners of RABs through phosphorylation (PubMed:26824392, PubMed:28720718, PubMed:29125462, PubMed:29127255, PubMed:29212815, PubMed:30398148, PubMed:30635421). Phosphorylates RAB3A, RAB3B, RAB3C, RAB3D, RAB5A, RAB5B, RAB5C, RAB8A, RAB8B, RAB10, RAB12, RAB29, RAB35, and RAB43 (PubMed:23395371, PubMed:26824392, PubMed:28720718, PubMed:29125462, PubMed:29127255, PubMed:29212815, PubMed:30398148, PubMed:30635421, PubMed:38127736). Regulates the RAB3IP-catalyzed GDP/GTP exchange for RAB8A through the phosphorylation of 'Thr-72' on RAB8A (PubMed:26824392). Inhibits the interaction between RAB8A and GDI1 and/or GDI2 by phosphorylating 'Thr-72' on RAB8A (PubMed:26824392). Regulates primary ciliogenesis through phosphorylation of RAB8A and RAB10, which promotes SHH signaling in the brain (PubMed:29125462, PubMed:30398148). Together with RAB29, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose-6-phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner (PubMed:23395371). Regulates neuronal process morphology in the intact central nervous system (CNS) (PubMed:17114044). Plays a role in synaptic vesicle trafficking (PubMed:24687852). Plays an important role in recruiting SEC16A to endoplasmic reticulum exit sites (ERES) and in regulating ER to Golgi vesicle-mediated transport and ERES organization (PubMed:25201882). Positively regulates autophagy through a calcium-dependent activation of the CaMKK/AMPK signaling pathway (PubMed:22012985). The process involves activation of nicotinic acid adenine dinucleotide phosphate (NAADP) receptors, increase in lysosomal pH, and calcium release from lysosomes (PubMed:22012985). Phosphorylates PRDX3 (PubMed:21850687). By phosphorylating APP on 'Thr-743', which promotes the production and the nuclear translocation of the APP intracellular domain (AICD), regulates dopaminergic neuron apoptosis (PubMed:28720718). Acts as a positive regulator of innate immunity by mediating phosphorylation of RIPK2 downstream of NOD1 and NOD2, thereby enhancing RIPK2 activation (PubMed:27830463). Independent of its kinase activity, inhibits the proteasomal degradation of MAPT, thus promoting MAPT oligomerization and secretion (PubMed:26014385). In addition, has GTPase activity via its Roc domain which regulates LRRK2 kinase activity (PubMed:18230735, PubMed:26824392, PubMed:28720718, PubMed:29125462, PubMed:29212815). Recruited by RAB29/RAB7L1 to overloaded lysosomes where it phosphorylates and stabilizes RAB8A and RAB10 which promote lysosomal content release and suppress lysosomal enlargement through the EHBP1 and EHBP1L1 effector proteins (PubMed:30209220, PubMed:38227290)..
Molecular Weight
>200 kDa
Synonyms
Leucine-rich repeat serine/threonine-protein kinase 2 (EC 2.7.11.1) (Dardarin)

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCICC
Specificity
No cross-reactivity reported
Clone
8G10
Isotype
IgG1
Form
Liquid
Immunogen
Fusion protein amino acids 100-500 (N-terminus) of human LRRK2 (accession number Q5S007) produced recombinantly in E. Coli.
Immunogen Species
Human
Host Species
Mouse
Species Reactivity
HumanMouseRat