AntibodiesNeuroMab
Anti-LRRK2/Dardarin, N-Terminus Antibody-Oligo Conjugate
SKU: aoc27
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LRRK2/Dardarin, N-Terminus Antibody-IF1
Antibody Target
- Target
- LRRK2/Dardarin, N-terminus
- UniProt Number
- Q5S007
- Target Description
- LRRK2 (also known as PARK8) encodes a protein with 5 putative functional domains: an N-terminal leucine-rich repeat (LRR) domain, a Roc (Ras of complex protein) domain that shares sequence homology to the Ras-related GTPase superfamily, a COR (C-terminal of Roc) domain, a mitogen-activated protein kinase kinase kinase (MAPKKK) domain, and a C-terminal WD40 repeat domain. Mutation in this gene is one of the most common causes of inherited Parkinson disease (Gandhi et al., 2008). LRRK2 was originally identified as a putative disease-causing transcript (DKFZp434H2111) within a 2.6-Mb region encompassing a locus for Parkinson disease-8 (PARK8). Northern blot analysis detected a 9-kb mRNA transcript in all tissues tested, including brain. The authors named the protein product dardarin, derived from the Basque word dardara, meaning tremor. LRRK2/dardarin is also known to positively regulate autophagy through a calcium-dependent activation of the CaMKK/AMPK signaling pathway and together with RAB29, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose 6 phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner. LRRK2/PARK8 is also known to regulate neuronal process morphology in the intact central nervous system (CNS) and play a role in synaptic vesicle trafficking.
- Molecular Weight
- >200 kDa
- Synonyms
- Leucine-rich repeat serine/threonine-protein kinase 2 (EC 2.7.11.1) (Dardarin)
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICC
- Specificity
- No cross-reactivity reported
- Clone
- 8G10
- Isotype
- IgG1
- Form
- Liquid
- Immunogen
- Fusion protein amino acids 100-500 (N-terminus) of human LRRK2 (accession number Q5S007) produced recombinantly in E. Coli.
- Immunogen Species
- Human
- Host Species
- Mouse
- Species Reactivity
- HumanMouseRat