Antibodies
Anti-LTA4H Antibody-Oligo Conjugate
SKU: aoc2628
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LTA4H Antibody-IF1
Antibody Target
- Target
- Leukotriene A-4 hydrolase
- UniProt Number
- P09960
- Target Description
- Bifunctional zinc metalloenzyme that comprises both epoxide hydrolase (EH) and aminopeptidase activities. Acts as an epoxide hydrolase to catalyze the conversion of LTA4 to the pro-inflammatory mediator leukotriene B4 (LTB4). Also has aminopeptidase activity, with high affinity for N-terminal arginines of various synthetic tripeptides. In addition to its pro-inflammatory EH activity, may also counteract inflammation by its aminopeptidase activity, which inactivates by cleavage another neutrophil attractant, the tripeptide Pro-Gly-Pro (PGP), a bioactive fragment of collagen generated by the action of matrix metalloproteinase-9 (MMP9) and prolylendopeptidase (PREPL). Involved also in the biosynthesis of resolvin E1 and 18S-resolvin E1 from eicosapentaenoic acid, two lipid mediators that show potent anti-inflammatory and pro-resolving actions.
- Molecular Weight
- 69kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1351
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat