Antibodies
Anti-LXR alpha Antibody-Oligo Conjugate
SKU: aoc2630
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LXR alpha Antibody-IF1
Antibody Target
- Target
- Oxysterols receptor LXR-alpha
- UniProt Number
- Q13133
- Target Description
- Nuclear receptor that exhibits a ligand-dependent transcriptional activation activity (PubMed:19481530, PubMed:25661920, PubMed:37478846). Interaction with retinoic acid receptor (RXR) shifts RXR from its role as a silent DNA-binding partner to an active ligand-binding subunit in mediating retinoid responses through target genes defined by LXRES (PubMed:37478846). LXRES are DR4-type response elements characterized by direct repeats of two similar hexanuclotide half-sites spaced by four nucleotides (By similarity). Plays an important role in the regulation of cholesterol homeostasis, regulating cholesterol uptake through MYLIP-dependent ubiquitination of LDLR, VLDLR and LRP8 (PubMed:19481530). Interplays functionally with RORA for the regulation of genes involved in liver metabolism (By similarity). Induces LPCAT3-dependent phospholipid remodeling in endoplasmic reticulum (ER) membranes of hepatocytes, driving SREBF1 processing and lipogenesis (By similarity). Via LPCAT3, triggers the incorporation of arachidonate into phosphatidylcholines of ER membranes, increasing membrane dynamics and enabling triacylglycerols transfer to nascent very low-density lipoprotein (VLDL) particles. Via LPCAT3 also counteracts lipid-induced ER stress response and inflammation, likely by modulating SRC kinase membrane compartmentalization and limiting the synthesis of lipid inflammatory mediators (By similarity)..
- Molecular Weight
- 50kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC0877
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat