Antibodies
Anti- LXR beta/NER Antibody-Oligo Conjugate
SKU: aoc1016
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti- LXR beta/NER Antibody-PLA1
Antibody Target
- Target
- Oxysterols receptor LXR-beta
- UniProt Number
- P55055
- Target Description
- Nuclear receptor that exhibits a ligand-dependent transcriptional activation activity. Binds preferentially to double-stranded oligonucleotide direct repeats having the consensus half-site sequence 5'-AGGTCA-3' and 4-nt spacing (DR-4). Regulates cholesterol uptake through MYLIP-dependent ubiquitination of LDLR, VLDLR and LRP8; DLDLR and LRP8. Interplays functionally with RORA for the regulation of genes involved in liver metabolism. Induces LPCAT3-dependent phospholipid remodeling in endoplasmic reticulum (ER) membranes of hepatocytes, driving SREBF1 processing and lipogenesis. Via LPCAT3, triggers the incorporation of arachidonate into phosphatidylcholines of ER membranes, increasing membrane dynamics and enabling triacylglycerols transfer to nascent very low-density lipoprotein (VLDL) particles. Via LPCAT3 also counteracts lipid-induced ER stress response and inflammation, likely by modulating SRC kinase membrane compartmentalization and limiting the synthesis of lipid inflammatory mediators. Plays an anti-inflammatory role during the hepatic acute phase response by acting as a corepressor: inhibits the hepatic acute phase response by preventing dissociation of the N-Cor corepressor complex.
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC69989
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human