Antibodies
Anti- LYPLA1 Antibody-Oligo Conjugate
SKU: aoc1017
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti- LYPLA1 Antibody-IF1
Antibody Target
- Target
- Acyl-protein thioesterase 1
- UniProt Number
- O75608
- Target Description
- Acts as an acyl-protein thioesterase. Hydrolyzes fatty acids from S-acylated cysteine residues in proteins such as trimeric G alpha proteins or HRAS. Acts as a palmitoyl thioesterase that catalyzes depalmitoylation of proteins, such as ADRB2, KCNMA1 and SQSTM1. Acts as a negative regulator of autophagy by mediating palmitoylation of SQSTM1, decreasing affinity between SQSTM1 and ATG8 proteins and recruitment of ubiquitinated cargo proteins to autophagosomes. Acts as a lysophospholipase and hydrolyzes lysophosphatidylcholine (lyso-PC). Also hydrolyzes lysophosphatidylethanolamine (lyso-PE), lysophosphatidylinositol (lyso-PI) and lysophosphatidylserine (lyso-PS). Has much higher thioesterase activity than lysophospholipase activity. Contributes to the production of lysophosphatidic acid (LPA) during blood coagulation by recognizing and cleaving plasma phospholipids to generate lysophospholipids which in turn act as substrates for ENPP2 to produce LPA.
- Molecular Weight
- 25kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC71341
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat