Antibodies
Anti-LysRS/KARS Antibody-Oligo Conjugate
SKU: aoc2633
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-LysRS/KARS Antibody-IF1
Antibody Target
- Target
- Lysine--tRNA ligase
- UniProt Number
- Q15046
- Target Description
- Catalyzes the specific attachment of an amino acid to its cognate tRNA in a 2 step reaction: the amino acid (AA) is first activated by ATP to form AA-AMP and then transferred to the acceptor end of the tRNA. When secreted, acts as a signaling molecule that induces immune response through the activation of monocyte/macrophages. Catalyzes the synthesis of the signaling molecule diadenosine tetraphosphate (Ap4A), and thereby mediates disruption of the complex between HINT1 and MITF and the concomitant activation of MITF transcriptional activity.; FUNCTION: (Microbial infection) Interacts with HIV-1 virus GAG protein, facilitating the selective packaging of tRNA(3)(Lys), the primer for reverse transcription initiation.
- Molecular Weight
- 68kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC1765
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat