Antibodies
Anti-macroH2A.1 Antibody-Oligo Conjugate
SKU: aoc2636
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-macroH2A.1 Antibody-IF1
Antibody Target
- Target
- Core histone macro-H2A.1
- UniProt Number
- O75367
- Target Description
- Variant histone H2A which replaces conventional H2A in a subset of nucleosomes where it represses transcription (PubMed:12718888, PubMed:15621527, PubMed:16428466). Nucleosomes wrap and compact DNA into chromatin, limiting DNA accessibility to the cellular machineries which require DNA as a template (PubMed:15897469). Histones thereby play a central role in transcription regulation, DNA repair, DNA replication and chromosomal stability (PubMed:15897469). DNA accessibility is regulated via a complex set of post-translational modifications of histones, also called histone code, and nucleosome remodeling. Involved in stable X chromosome inactivation (PubMed:15897469). Inhibits the binding of transcription factors, including NF-kappa-B, and interferes with the activity of remodeling SWI/SNF complexes (PubMed:12718888, PubMed:16428466). Inhibits histone acetylation by EP300 and recruits class I HDACs, which induces a hypoacetylated state of chromatin (PubMed:16107708, PubMed:16428466)..; FUNCTION: [Isoform 1]: Isoform that specifically binds poly-ADP-ribose and O-acetyl-ADP-ribose and plays a key role in NAD(+) metabolism (PubMed:15902274). Able to bind to the ends of poly-ADP-ribose chains created by PARP1 and cap them (By similarity). This prevents PARP1 from further addition of ADP-ribose and thus limits the consumption of nuclear NAD(+), allowing the cell to maintain proper NAD(+) levels in both the nucleus and the mitochondria to promote proper mitochondrial respiration (By similarity). Increases the expression of genes involved in redox metabolism, including SOD3 (PubMed:23022728)..; FUNCTION: [Isoform 2]: In contrast to isoform 1, does not bind poly-ADP-ribose (PubMed:15902274). Represses SOD3 gene expression (PubMed:23022728)..
- Molecular Weight
- 39kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1396
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat