Antibodies
Anti-MAD2L1BP Antibody-Oligo Conjugate
SKU: aoc2639
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MAD2L1BP Antibody-IF1
Antibody Target
- Target
- MAD2L1-binding protein
- UniProt Number
- Q15013
- Target Description
- May function to silence the spindle checkpoint and allow mitosis to proceed through anaphase by binding MAD2L1 after it has become dissociated from the MAD2L1-CDC20 complex.
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCICCELISA
- Clone
- ARC2187
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- A synthetic peptide corresponding to a sequence within amino acids 175-274 of human MAD2L1BP (Q15013).
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse