Antibodies
Anti-MAOB Antibody-Oligo Conjugate
SKU: aoc2646
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MAOB Antibody-IF1
Antibody Target
- Target
- Amine oxidase [flavin-containing] B
- UniProt Number
- P27338
- Target Description
- Catalyzes the oxidative deamination of primary and some secondary amines such as neurotransmitters, and exogenous amines including the tertiary amine, neurotoxin 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), with concomitant reduction of oxygen to hydrogen peroxide and participates in the metabolism of neuroactive and vasoactive amines in the central nervous system and peripheral tissues. Preferentially degrades benzylamine and phenylethylamine.
- Molecular Weight
- 59kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC0641
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat