Antibodies
Anti-Mast Cell Tryptase (TPSB2) Antibody-Oligo Conjugate
SKU: aoc2652
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Mast Cell Tryptase (TPSB2) Antibody-IF1
Antibody Target
- Target
- Tryptase alpha/beta-1
- UniProt Number
- Q15661
- Target Description
- Tryptase is the major neutral protease present in mast cells and is secreted upon the coupled activation-degranulation response of this cell type. May play a role in innate immunity. Isoform 2 cleaves large substrates, such as fibronectin, more efficiently than isoform 1, but seems less efficient toward small substrates (PubMed:18854315)..
- Molecular Weight
- 31kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2328
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat