Antibodies
Anti-Matrin 3 Antibody-Oligo Conjugate
SKU: aoc2654
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Matrin 3 Antibody-IF1
Antibody Target
- Target
- Matrin-3
- UniProt Number
- P43243
- Target Description
- May play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. In association with the SFPQ-NONO heteromer may play a role in nuclear retention of defective RNAs. Plays a role in the regulation of DNA virus-mediated innate immune response by assembling into the HDP-RNP complex, a complex that serves as a platform for IRF3 phosphorylation and subsequent innate immune response activation through the cGAS-STING pathway (PubMed:28712728). Binds to N6-methyladenosine (m6A)-containing mRNAs and contributes to MYC stability by binding to m6A-containing MYC mRNAs (PubMed:32245947). May bind to specific miRNA hairpins (PubMed:28431233)..
- Molecular Weight
- 95kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1854
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat