Antibodies
Anti-MAVS Antibody-Oligo Conjugate
SKU: aoc2655
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MAVS Antibody-IF1
Antibody Target
- Target
- Mitochondrial antiviral-signaling protein
- UniProt Number
- Q7Z434
- Target Description
- Adapter required for innate immune defense against viruses (PubMed:16125763, PubMed:16127453, PubMed:16153868, PubMed:16177806, PubMed:19631370, PubMed:20127681, PubMed:20451243, PubMed:21170385, PubMed:23087404, PubMed:27992402, PubMed:33139700, PubMed:37582970). Acts downstream of DHX33, RIGI and IFIH1/MDA5, which detect intracellular dsRNA produced during viral replication, to coordinate pathways leading to the activation of NF-kappa-B, IRF3 and IRF7, and to the subsequent induction of antiviral cytokines such as IFNB and RANTES (CCL5) (PubMed:16125763, PubMed:16127453, PubMed:16153868, PubMed:16177806, PubMed:19631370, PubMed:20127681, PubMed:20451243, PubMed:20628368, PubMed:21170385, PubMed:23087404, PubMed:25636800, PubMed:27736772, PubMed:33110251). Peroxisomal and mitochondrial MAVS act sequentially to create an antiviral cellular state (PubMed:20451243). Upon viral infection, peroxisomal MAVS induces the rapid interferon-independent expression of defense factors that provide short-term protection, whereas mitochondrial MAVS activates an interferon-dependent signaling pathway with delayed kinetics, which amplifies and stabilizes the antiviral response (PubMed:20451243). May activate the same pathways following detection of extracellular dsRNA by TLR3 (PubMed:16153868). May protect cells from apoptosis (PubMed:16125763). Involved in NLRP3 inflammasome activation by mediating NLRP3 recruitment to mitochondria (PubMed:23582325)..
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC61547
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse