Antibodies
Anti-MAVS Antibody-Oligo Conjugate
SKU: aoc2655
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MAVS Antibody-IF1
Antibody Target
- Target
- Mitochondrial antiviral-signaling protein
- UniProt Number
- Q7Z434
- Target Description
- Adapter required for innate immune defense against viruses. Acts downstream of DHX33, RIGI and IFIH1/MDA5, which detect intracellular dsRNA produced during viral replication, to coordinate pathways leading to the activation of NF-kappa-B, IRF3 and IRF7, and to the subsequent induction of antiviral cytokines such as IFNB and RANTES (CCL5). Peroxisomal and mitochondrial MAVS act sequentially to create an antiviral cellular state. Upon viral infection, peroxisomal MAVS induces the rapid interferon-independent expression of defense factors that provide short-term protection, whereas mitochondrial MAVS activates an interferon-dependent signaling pathway with delayed kinetics, which amplifies and stabilizes the antiviral response. May activate the same pathways following detection of extracellular dsRNA by TLR3. May protect cells from apoptosis. Involved in NLRP3 inflammasome activation by mediating NLRP3 recruitment to mitochondria.
- Molecular Weight
- 57kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC61547
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse