Antibodies
Anti-MBD3 Antibody-Oligo Conjugate
SKU: aoc2657
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MBD3 Antibody-IF1
Antibody Target
- Target
- Methyl-CpG-binding domain protein 3
- UniProt Number
- O95983
- Target Description
- Acts as a component of the histone deacetylase NuRD complex which participates in the remodeling of chromatin (PubMed:12124384, PubMed:16428440, PubMed:28977666). Acts as transcriptional repressor and plays a role in gene silencing (PubMed:10947852, PubMed:18644863). Does not bind to methylated DNA by itself (PubMed:12124384, PubMed:16428440). Binds to a lesser degree DNA containing unmethylated CpG dinucleotides (PubMed:24307175). Recruits histone deacetylases and DNA methyltransferases..
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2466
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat