Antibodies
Anti-MBNL1 Antibody-Oligo Conjugate
SKU: aoc2658
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MBNL1 Antibody-IF1
Antibody Target
- Target
- Muscleblind-like protein 1
- UniProt Number
- Q9NR56
- Target Description
- Mediates pre-mRNA alternative splicing regulation. Acts either as activator or repressor of splicing on specific pre-mRNA targets. Inhibits cardiac troponin-T (TNNT2) pre-mRNA exon inclusion but induces insulin receptor (IR) pre-mRNA exon inclusion in muscle. Antagonizes the alternative splicing activity pattern of CELF proteins. Regulates the TNNT2 exon 5 skipping through competition with U2AF2. Inhibits the formation of the spliceosome A complex on intron 4 of TNNT2 pre-mRNA. Binds to the stem-loop structure within the polypyrimidine tract of TNNT2 intron 4 during spliceosome assembly. Binds to the 5'-YGCU(U/G)Y-3'consensus sequence. Binds to the IR RNA. Binds to expanded CUG repeat RNA, which folds into a hairpin structure containing GC base pairs and bulged, unpaired U residues. Together with RNA binding proteins RBPMS and RBFOX2, activates vascular smooth muscle cells alternative splicing events (PubMed:37548402). Regulates NCOR2 alternative splicing (By similarity)..
- Molecular Weight
- 42kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC1199
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human