Antibodies
Anti-MBTPS1 Antibody-Oligo Conjugate
SKU: aoc2659
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MBTPS1 Antibody-IF1
Antibody Target
- Target
- Membrane-bound transcription factor site-1 protease
- UniProt Number
- Q14703
- Target Description
- Serine protease that cleaves after hydrophobic or small residues, provided that Arg or Lys is in position P4: known substrates include SREBF1/SREBP1, SREBF2/SREBP2, BDNF, GNPTAB, ATF6, ATF6B and FAM20C (PubMed:10644685, PubMed:12782636, PubMed:21719679, PubMed:34349020). Cleaves substrates after Arg-Ser-Val-Leu (SREBP2), Arg-His-Leu-Leu (ATF6), Arg-Gly-Leu-Thr (BDNF) and its own propeptide after Arg-Arg-Leu-Leu (PubMed:10644685, PubMed:21719679). Catalyzes the first step in the proteolytic activation of the sterol regulatory element-binding proteins (SREBPs) SREBF1/SREBP1 and SREBF2/SREBP2 (PubMed:12782636). Also mediates the first step in the proteolytic activation of the cyclic AMP-dependent transcription factor ATF-6 (ATF6 and ATF6B) (PubMed:12782636). Mediates the protein cleavage of GNPTAB into subunit alpha and beta, thereby participating in biogenesis of lysosomes (PubMed:21719679). Cleaves the propeptide from FAM20C which is required for FAM20C secretion from the Golgi apparatus membrane and for enhancement of FAM20C kinase activity, promoting osteoblast differentiation and biomineralization (PubMed:34349020). Involved in the regulation of M6P-dependent Golgi-to-lysosome trafficking of lysosomal enzymes (PubMed:21719679, PubMed:30046013). It is required for the activation of CREB3L2/BBF2H7, a transcriptional activator of MIA3/TANGO and other genes controlling mega vesicle formation (PubMed:30046013). Therefore, it plays a key role in the regulation of mega vesicle-mediated collagen trafficking (PubMed:30046013). In astrocytes and osteoblasts, upon DNA damage and ER stress, mediates the first step of the regulated intramembrane proteolytic activation of the transcription factor CREB3L1, leading to the inhibition of cell-cycle progression (PubMed:16417584)..
- Molecular Weight
- 118kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC72174_ARC72176
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat