Antibodies
Anti-MBTPS1 Antibody-Oligo Conjugate
SKU: aoc2659
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MBTPS1 Antibody-IF1
Antibody Target
- Target
- Membrane-bound transcription factor site-1 protease
- UniProt Number
- Q14703
- Target Description
- Serine protease that cleaves after hydrophobic or small residues, provided that Arg or Lys is in position P4: known substrates include SREBF1/SREBP1, SREBF2/SREBP2, BDNF, GNPTAB, ATF6, ATF6B and FAM20C. Cleaves substrates after Arg-Ser-Val-Leu (SREBP2), Arg-His-Leu-Leu (ATF6), Arg-Gly-Leu-Thr (BDNF) and its own propeptide after Arg-Arg-Leu-Leu. Catalyzes the first step in the proteolytic activation of the sterol regulatory element-binding proteins (SREBPs) SREBF1/SREBP1 and SREBF2/SREBP2. Also mediates the first step in the proteolytic activation of the cyclic AMP-dependent transcription factor ATF-6 (ATF6 and ATF6B). Mediates the protein cleavage of GNPTAB into subunit alpha and beta, thereby participating in biogenesis of lysosomes. Cleaves the propeptide from FAM20C which is required for FAM20C secretion from the Golgi apparatus membrane and for enhancement of FAM20C kinase activity, promoting osteoblast differentiation and biomineralization. Involved in the regulation of M6P-dependent Golgi-to-lysosome trafficking of lysosomal enzymes. It is required for the activation of CREB3L2/BBF2H7, a transcriptional activator of MIA3/TANGO and other genes controlling mega vesicle formation. Therefore, it plays a key role in the regulation of mega vesicle-mediated collagen trafficking. In astrocytes and osteoblasts, upon DNA damage and ER stress, mediates the first step of the regulated intramembrane proteolytic activation of the transcription factor CREB3L1, leading to the inhibition of cell-cycle progression.
- Molecular Weight
- 118kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC72174_ARC72176
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat