Antibodies
Anti-MCM2 Antibody-Oligo Conjugate (ARC2596)
SKU: aoc2664
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MCM2 Antibody (ARC2596)-IF1
Antibody Target
- Target
- DNA replication licensing factor MCM2
- UniProt Number
- P49736
- Target Description
- Acts as a component of the MCM2-7 complex (MCM complex) which is the replicative helicase essential for 'once per cell cycle' DNA replication initiation and elongation in eukaryotic cells. Core component of CDC45-MCM-GINS (CMG) helicase, the molecular machine that unwinds template DNA during replication, and around which the replisome is built. The active ATPase sites in the MCM2-7 ring are formed through the interaction surfaces of two neighboring subunits such that a critical structure of a conserved arginine finger motif is provided in trans relative to the ATP-binding site of the Walker A box of the adjacent subunit. The six ATPase active sites, however, are likely to contribute differentially to the complex helicase activity. Required for the entry in S phase and for cell division. Plays a role in terminally differentiated hair cells development of the cochlea and induces cells apoptosis.
- Molecular Weight
- 102kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC2596
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat