Antibodies
Anti-Meckelin Antibody-Oligo Conjugate
SKU: aoc2677
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Meckelin Antibody-IF1
Antibody Target
- Target
- Meckelin
- UniProt Number
- Q5HYA8
- Target Description
- Required for ciliary structure and function. Part of the tectonic-like complex which is required for tissue-specific ciliogenesis and may regulate ciliary membrane composition. Involved in centrosome migration to the apical cell surface during early ciliogenesis. Involved in the regulation of cilia length and appropriate number through the control of centrosome duplication. Is a key regulator of stereociliary bundle orientation. Required for epithelial cell branching morphology. Essential for endoplasmic reticulum-associated degradation (ERAD) of surfactant protein C (SFTPC). Involved in the negative regulation of canonical Wnt signaling, and activation of the non-canonical cascade stimulated by WNT5A. In non-canonical Wnt signaling, it may act as ROR2 coreceptor.
- Molecular Weight
- 112kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC3051
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat