Antibodies
Anti-MED4 Antibody-Oligo Conjugate
SKU: aoc2679
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MED4 Antibody-IF1
Antibody Target
- Target
- Mediator of RNA polymerase II transcription subunit 4
- UniProt Number
- Q9NPJ6
- Target Description
- Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors.
- Molecular Weight
- 30kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2528
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat