Antibodies
Anti-MEF2A+MEF2C Antibody-Oligo Conjugate
SKU: aoc2680
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MEF2A+MEF2C Antibody-IF1
Antibody Target
- Target
- Myocyte-specific enhancer factor 2C
- UniProt Number
- Q06413
- Additional Target Information
- This antibody also binds Myocyte-specific enhancer factor 2A, Uniprot:Q02078.
- Target Description
- Transcription activator which binds specifically to the MEF2 element present in the regulatory regions of many muscle-specific genes. Controls cardiac morphogenesis and myogenesis, and is also involved in vascular development. Enhances transcriptional activation mediated by SOX18. Plays an essential role in hippocampal-dependent learning and memory by suppressing the number of excitatory synapses and thus regulating basal and evoked synaptic transmission. Crucial for normal neuronal development, distribution, and electrical activity in the neocortex. Necessary for proper development of megakaryocytes and platelets and for bone marrow B-lymphopoiesis. Required for B-cell survival and proliferation in response to BCR stimulation, efficient IgG1 antibody responses to T-cell-dependent antigens and for normal induction of germinal center B-cells. May also be involved in neurogenesis and in the development of cortical architecture. Isoforms that lack the repressor domain are more active than isoform 1.
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2661
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse