Antibodies
Anti-MEK1 Antibody-Oligo Conjugate
SKU: aoc2682
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MEK1 Antibody-IF1
Antibody Target
- Target
- Dual specificity mitogen-activated protein kinase kinase 1
- UniProt Number
- Q02750
- Target Description
- Dual specificity protein kinase which acts as an essential component of the MAP kinase signal transduction pathway. Binding of extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation. RAF1 then further activates the dual-specificity protein kinases MAP2K1/MEK1 and MAP2K2/MEK2. Both MAP2K1/MEK1 and MAP2K2/MEK2 function specifically in the MAPK/ERK cascade, and catalyze the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in the extracellular signal-regulated kinases MAPK3/ERK1 and MAPK1/ERK2, leading to their activation and further transduction of the signal within the MAPK/ERK cascade. Activates BRAF in a KSR1 or KSR2-dependent manner; by binding to KSR1 or KSR2 releases the inhibitory intramolecular interaction between KSR1 or KSR2 protein kinase and N-terminal domains which promotes KSR1 or KSR2-BRAF dimerization and BRAF activation. Depending on the cellular context, this pathway mediates diverse biological functions such as cell growth, adhesion, survival and differentiation, predominantly through the regulation of transcription, metabolism and cytoskeletal rearrangements. One target of the MAPK/ERK cascade is peroxisome proliferator-activated receptor gamma (PPARG), a nuclear receptor that promotes differentiation and apoptosis. MAP2K1/MEK1 has been shown to export PPARG from the nucleus. The MAPK/ERK cascade is also involved in the regulation of endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC), as well as in the fragmentation of the Golgi apparatus during mitosis.
- Molecular Weight
- 43kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIPELISA
- Clone
- ARC0044
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat