Antibodies
Anti-MEKK2 Antibody-Oligo Conjugate
SKU: aoc2687
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-MEKK2 Antibody-IF1
Antibody Target
- Target
- Mitogen-activated protein kinase kinase kinase 2
- UniProt Number
- Q9Y2U5
- Target Description
- Component of a protein kinase signal transduction cascade. Regulates the JNK and ERK5 pathways by phosphorylating and activating MAP2K5 and MAP2K7 (By similarity). Plays a role in caveolae kiss-and-run dynamics..
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC2291
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat