Antibodies
Anti-Melanoma Antibody-Oligo Conjugate
SKU: aoc2690
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Melanoma Antibody-IF1
Antibody Target
- Target
- Tyrosinase
- UniProt Number
- P14679
- Target Description
- This is a copper-containing oxidase that functions in the formation of pigments such as melanins and other polyphenolic compounds. Catalyzes the initial and rate limiting step in the cascade of reactions leading to melanin production from tyrosine. In addition to hydroxylating tyrosine to DOPA (3,4-dihydroxyphenylalanine), also catalyzes the oxidation of DOPA to DOPA-quinone, and possibly the oxidation of DHI (5,6-dihydroxyindole) to indole-5,6 quinone.
- Molecular Weight
- 43 kDa/60 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC79828
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse