Antibodies
Anti-Melanoma gp100 Antibody-Oligo Conjugate
SKU: aoc2691
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Melanoma gp100 Antibody-IF1
Antibody Target
- Target
- Melanocyte protein PMEL
- UniProt Number
- P40967
- Target Description
- Forms physiological amyloids that play a central role in melanosome morphogenesis and pigmentation. The maturation of unpigmented premelanosomes from stage I to II is marked by assembly of processed amyloidogenic fragments into parallel fibrillar sheets, which elongate the vesicle into a striated ellipsoidal shape. In pigmented stage III and IV melanosomes, the amyloid matrix serves as a platform where eumelanin precursors accumulate at high local concentrations for pigment formation. May prevent pigmentation-associated toxicity by sequestering toxic reaction intermediates of eumelanin biosynthesis pathway..; FUNCTION: Represents a potent melanoma-specific antigen. Among melanoma non-mutated self-peptides, G9-154 (KTWGQYWQV), G9-209 (ITDQVPFSV) and G9-280 (YLEPGPVTA), appear to act as immunodominant common epitopes that stimulate anti-tumor immune response mediated by HLA-A-restricted cytotoxic T cells..
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59527
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human