Antibodies
Anti-Mesothelin Antibody-Oligo Conjugate (ARC54390)
SKU: aoc2696
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Mesothelin Antibody (ARC54390)-IF1
Antibody Target
- Target
- Mesothelin
- UniProt Number
- Q13421
- Target Description
- Membrane-anchored forms may play a role in cellular adhesion.; FUNCTION: Megakaryocyte-potentiating factor (MPF) potentiates megakaryocyte colony formation in vitro.
- Molecular Weight
- 69kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC54390
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human