Antibodies

Anti-METTL3 Antibody-Oligo Conjugate

SKU: aoc2701

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-METTL3 Antibody-IF1

Antibody Target

Target
N
UniProt Number
Q86U44
Target Description
The METTL3-METTL14 heterodimer forms a N6-methyltransferase complex that methylates adenosine residues at the N(6) position of some RNAs and regulates various processes such as the circadian clock, differentiation of embryonic and hematopoietic stem cells, cortical neurogenesis, response to DNA damage, differentiation of T-cells and primary miRNA processing. In the heterodimer formed with METTL14, METTL3 constitutes the catalytic core. N6-methyladenosine (m6A), which takes place at the 5'-[AG]GAC-3' consensus sites of some mRNAs, plays a role in mRNA stability, processing, translation efficiency and editing. M6A acts as a key regulator of mRNA stability: methylation is completed upon the release of mRNA into the nucleoplasm and promotes mRNA destabilization and degradation. In embryonic stem cells (ESCs), m6A methylation of mRNAs encoding key naive pluripotency-promoting transcripts results in transcript destabilization, promoting differentiation of ESCs. M6A regulates the length of the circadian clock: acts as an early pace-setter in the circadian loop by putting mRNA production on a fast-track for facilitating nuclear processing, thereby providing an early point of control in setting the dynamics of the feedback loop. M6A also regulates circadian regulation of hepatic lipid metabolism. M6A regulates spermatogonial differentiation and meiosis and is essential for male fertility and spermatogenesis. Also required for oogenesis. Involved in the response to DNA damage: in response to ultraviolet irradiation, METTL3 rapidly catalyzes the formation of m6A on poly(A) transcripts at DNA damage sites, leading to the recruitment of POLK to DNA damage sites. M6A is also required for T-cell homeostasis and differentiation: m6A methylation of transcripts of SOCS family members (SOCS1, SOCS3 and CISH) in naive T-cells promotes mRNA destabilization and degradation, promoting T-cell differentiation. Inhibits the type I interferon response by mediating m6A methylation of IFNB. M6A also takes place in other RNA molecules, such as primary miRNA (pri-miRNAs). Mediates m6A methylation of Xist RNA, thereby participating in random X inactivation: m6A methylation of Xist leads to target YTHDC1 reader on Xist and promote transcription repression activity of Xist. M6A also regulates cortical neurogenesis: m6A methylation of transcripts related to transcription factors, neural stem cells, the cell cycle and neuronal differentiation during brain development promotes their destabilization and decay, promoting differentiation of radial glial cells. METTL3 mediates methylation of pri-miRNAs, marking them for recognition and processing by DGCR8. Acts as a positive regulator of mRNA translation independently of the methyltransferase activity: promotes translation by interacting with the translation initiation machinery in the cytoplasm. Its overexpression in a number of cancer cells suggests that it may participate in cancer cell proliferation by promoting mRNA translation. During human coronavirus SARS-CoV-2 infection, adds m6A modifications in SARS-CoV-2 RNA leading to decreased RIGI binding and subsequently dampening the sensing and activation of innate immune responses.
Molecular Weight
64 kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIPICCIHCChIPELISA
Clone
ARC66900
Isotype
IgG
Form
Liquid
Immunogen
Recombinant protein (or fragment).This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat